ID: 1185519467

View in Genome Browser
Species Human (GRCh38)
Location X:728022-728044
Sequence AGCTGGACGCTGCAAATTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185519455_1185519467 21 Left 1185519455 X:727978-728000 CCAGGGTGATGTGGGCCCCTCCC No data
Right 1185519467 X:728022-728044 AGCTGGACGCTGCAAATTCGCGG No data
1185519457_1185519467 5 Left 1185519457 X:727994-728016 CCCTCCCTCTTGCGCTGCCCCTG No data
Right 1185519467 X:728022-728044 AGCTGGACGCTGCAAATTCGCGG No data
1185519458_1185519467 4 Left 1185519458 X:727995-728017 CCTCCCTCTTGCGCTGCCCCTGG No data
Right 1185519467 X:728022-728044 AGCTGGACGCTGCAAATTCGCGG No data
1185519461_1185519467 1 Left 1185519461 X:727998-728020 CCCTCTTGCGCTGCCCCTGGGCT No data
Right 1185519467 X:728022-728044 AGCTGGACGCTGCAAATTCGCGG No data
1185519456_1185519467 6 Left 1185519456 X:727993-728015 CCCCTCCCTCTTGCGCTGCCCCT No data
Right 1185519467 X:728022-728044 AGCTGGACGCTGCAAATTCGCGG No data
1185519462_1185519467 0 Left 1185519462 X:727999-728021 CCTCTTGCGCTGCCCCTGGGCTG No data
Right 1185519467 X:728022-728044 AGCTGGACGCTGCAAATTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185519467 Original CRISPR AGCTGGACGCTGCAAATTCG CGG Intergenic
No off target data available for this crispr