ID: 1185519511

View in Genome Browser
Species Human (GRCh38)
Location X:728348-728370
Sequence CCTTCAACACACAGGGAACG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185519502_1185519511 29 Left 1185519502 X:728296-728318 CCCAGCTTTGCTAACGCCCTGGT No data
Right 1185519511 X:728348-728370 CCTTCAACACACAGGGAACGTGG No data
1185519505_1185519511 13 Left 1185519505 X:728312-728334 CCCTGGTGAGTGTCAGGTACAGA No data
Right 1185519511 X:728348-728370 CCTTCAACACACAGGGAACGTGG No data
1185519503_1185519511 28 Left 1185519503 X:728297-728319 CCAGCTTTGCTAACGCCCTGGTG No data
Right 1185519511 X:728348-728370 CCTTCAACACACAGGGAACGTGG No data
1185519506_1185519511 12 Left 1185519506 X:728313-728335 CCTGGTGAGTGTCAGGTACAGAT No data
Right 1185519511 X:728348-728370 CCTTCAACACACAGGGAACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185519511 Original CRISPR CCTTCAACACACAGGGAACG TGG Intergenic
No off target data available for this crispr