ID: 1185523459

View in Genome Browser
Species Human (GRCh38)
Location X:759170-759192
Sequence CAGGGCTAAGACACTGGACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185523453_1185523459 12 Left 1185523453 X:759135-759157 CCTCTAAGGTAGGAAGCAGGACA No data
Right 1185523459 X:759170-759192 CAGGGCTAAGACACTGGACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185523459 Original CRISPR CAGGGCTAAGACACTGGACC AGG Intergenic
No off target data available for this crispr