ID: 1185531408

View in Genome Browser
Species Human (GRCh38)
Location X:821938-821960
Sequence CATTCTGCATAGAGGGCCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185531408_1185531414 30 Left 1185531408 X:821938-821960 CCAAGGGCCCTCTATGCAGAATG No data
Right 1185531414 X:821991-822013 GAAGCTGTTTAACACGGAGAAGG No data
1185531408_1185531412 4 Left 1185531408 X:821938-821960 CCAAGGGCCCTCTATGCAGAATG No data
Right 1185531412 X:821965-821987 GCTTGGTCTAGCTTGAGATTTGG No data
1185531408_1185531413 24 Left 1185531408 X:821938-821960 CCAAGGGCCCTCTATGCAGAATG No data
Right 1185531413 X:821985-822007 TGGCAAGAAGCTGTTTAACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185531408 Original CRISPR CATTCTGCATAGAGGGCCCT TGG (reversed) Intergenic
No off target data available for this crispr