ID: 1185532106

View in Genome Browser
Species Human (GRCh38)
Location X:830242-830264
Sequence GGACCTGCATGGTTTTACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185532101_1185532106 1 Left 1185532101 X:830218-830240 CCGGGGGTGGGAACACAGAGCCT No data
Right 1185532106 X:830242-830264 GGACCTGCATGGTTTTACCTTGG No data
1185532093_1185532106 26 Left 1185532093 X:830193-830215 CCAGAGTAAGGGGGAAAAAAGGT No data
Right 1185532106 X:830242-830264 GGACCTGCATGGTTTTACCTTGG No data
1185532100_1185532106 2 Left 1185532100 X:830217-830239 CCCGGGGGTGGGAACACAGAGCC No data
Right 1185532106 X:830242-830264 GGACCTGCATGGTTTTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185532106 Original CRISPR GGACCTGCATGGTTTTACCT TGG Intergenic
No off target data available for this crispr