ID: 1185532224

View in Genome Browser
Species Human (GRCh38)
Location X:831104-831126
Sequence ATCTCGGGGAAACTAACTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185532224_1185532229 5 Left 1185532224 X:831104-831126 CCCTAAGTTAGTTTCCCCGAGAT No data
Right 1185532229 X:831132-831154 ATGATTTTAAAAATTGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185532224 Original CRISPR ATCTCGGGGAAACTAACTTA GGG (reversed) Intergenic
No off target data available for this crispr