ID: 1185532229

View in Genome Browser
Species Human (GRCh38)
Location X:831132-831154
Sequence ATGATTTTAAAAATTGCTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185532223_1185532229 12 Left 1185532223 X:831097-831119 CCTTGCGCCCTAAGTTAGTTTCC No data
Right 1185532229 X:831132-831154 ATGATTTTAAAAATTGCTATAGG No data
1185532225_1185532229 4 Left 1185532225 X:831105-831127 CCTAAGTTAGTTTCCCCGAGATG No data
Right 1185532229 X:831132-831154 ATGATTTTAAAAATTGCTATAGG No data
1185532224_1185532229 5 Left 1185532224 X:831104-831126 CCCTAAGTTAGTTTCCCCGAGAT No data
Right 1185532229 X:831132-831154 ATGATTTTAAAAATTGCTATAGG No data
1185532227_1185532229 -10 Left 1185532227 X:831119-831141 CCCGAGATGAAAGATGATTTTAA No data
Right 1185532229 X:831132-831154 ATGATTTTAAAAATTGCTATAGG No data
1185532226_1185532229 -9 Left 1185532226 X:831118-831140 CCCCGAGATGAAAGATGATTTTA No data
Right 1185532229 X:831132-831154 ATGATTTTAAAAATTGCTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185532229 Original CRISPR ATGATTTTAAAAATTGCTAT AGG Intergenic
No off target data available for this crispr