ID: 1185534809

View in Genome Browser
Species Human (GRCh38)
Location X:852570-852592
Sequence CTCCAATAACTTATGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185534809_1185534814 -7 Left 1185534809 X:852570-852592 CCCTTTTCCATAAGTTATTGGAG No data
Right 1185534814 X:852586-852608 ATTGGAGTACAGGTGGTATTTGG 0: 26
1: 366
2: 500
3: 937
4: 1819
1185534809_1185534815 3 Left 1185534809 X:852570-852592 CCCTTTTCCATAAGTTATTGGAG No data
Right 1185534815 X:852596-852618 AGGTGGTATTTGGTGACATGAGG No data
1185534809_1185534816 17 Left 1185534809 X:852570-852592 CCCTTTTCCATAAGTTATTGGAG No data
Right 1185534816 X:852610-852632 GACATGAGGAAGTTATTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185534809 Original CRISPR CTCCAATAACTTATGGAAAA GGG (reversed) Intergenic
No off target data available for this crispr