ID: 1185541742

View in Genome Browser
Species Human (GRCh38)
Location X:907828-907850
Sequence CCCGGCCAACCCTTGAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185541742_1185541747 13 Left 1185541742 X:907828-907850 CCTAAATTCAAGGGTTGGCCGGG No data
Right 1185541747 X:907864-907886 GCCTCTCATCCCAACACTTTGGG 0: 2
1: 363
2: 23693
3: 273193
4: 276919
1185541742_1185541751 22 Left 1185541742 X:907828-907850 CCTAAATTCAAGGGTTGGCCGGG No data
Right 1185541751 X:907873-907895 CCCAACACTTTGGGAGGCCGAGG 0: 6468
1: 135481
2: 274928
3: 207474
4: 120415
1185541742_1185541753 25 Left 1185541742 X:907828-907850 CCTAAATTCAAGGGTTGGCCGGG No data
Right 1185541753 X:907876-907898 AACACTTTGGGAGGCCGAGGCGG 0: 4825
1: 102576
2: 192656
3: 133596
4: 67130
1185541742_1185541754 26 Left 1185541742 X:907828-907850 CCTAAATTCAAGGGTTGGCCGGG No data
Right 1185541754 X:907877-907899 ACACTTTGGGAGGCCGAGGCGGG 0: 4869
1: 102263
2: 236828
3: 235016
4: 150982
1185541742_1185541746 12 Left 1185541742 X:907828-907850 CCTAAATTCAAGGGTTGGCCGGG No data
Right 1185541746 X:907863-907885 CGCCTCTCATCCCAACACTTTGG 0: 2
1: 193
2: 13437
3: 163924
4: 302895
1185541742_1185541749 16 Left 1185541742 X:907828-907850 CCTAAATTCAAGGGTTGGCCGGG No data
Right 1185541749 X:907867-907889 TCTCATCCCAACACTTTGGGAGG 0: 3
1: 506
2: 30376
3: 355369
4: 255925
1185541742_1185541755 29 Left 1185541742 X:907828-907850 CCTAAATTCAAGGGTTGGCCGGG No data
Right 1185541755 X:907880-907902 CTTTGGGAGGCCGAGGCGGGCGG 0: 39056
1: 119917
2: 190535
3: 147315
4: 99766

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185541742 Original CRISPR CCCGGCCAACCCTTGAATTT AGG (reversed) Intergenic
No off target data available for this crispr