ID: 1185543813

View in Genome Browser
Species Human (GRCh38)
Location X:925873-925895
Sequence CCTTTTGTGCATAAGCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185543809_1185543813 27 Left 1185543809 X:925823-925845 CCCGGGTTCTCTCAGGGGGAAAA No data
Right 1185543813 X:925873-925895 CCTTTTGTGCATAAGCCAGCTGG No data
1185543810_1185543813 26 Left 1185543810 X:925824-925846 CCGGGTTCTCTCAGGGGGAAAAT No data
Right 1185543813 X:925873-925895 CCTTTTGTGCATAAGCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185543813 Original CRISPR CCTTTTGTGCATAAGCCAGC TGG Intergenic
No off target data available for this crispr