ID: 1185544076

View in Genome Browser
Species Human (GRCh38)
Location X:927369-927391
Sequence CGAAGGGTGTGGACTCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185544076_1185544084 -6 Left 1185544076 X:927369-927391 CCCTCTGGAGTCCACACCCTTCG No data
Right 1185544084 X:927386-927408 CCTTCGTCAATTGGGCAACTGGG No data
1185544076_1185544082 -7 Left 1185544076 X:927369-927391 CCCTCTGGAGTCCACACCCTTCG No data
Right 1185544082 X:927385-927407 CCCTTCGTCAATTGGGCAACTGG No data
1185544076_1185544085 6 Left 1185544076 X:927369-927391 CCCTCTGGAGTCCACACCCTTCG No data
Right 1185544085 X:927398-927420 GGGCAACTGGGACCCTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185544076 Original CRISPR CGAAGGGTGTGGACTCCAGA GGG (reversed) Intergenic
No off target data available for this crispr