ID: 1185544165

View in Genome Browser
Species Human (GRCh38)
Location X:928701-928723
Sequence CTGGCTGCTCAGAGGAACTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185544158_1185544165 -7 Left 1185544158 X:928685-928707 CCAGGCCCCATCCATCCTGGCTG No data
Right 1185544165 X:928701-928723 CTGGCTGCTCAGAGGAACTGTGG No data
1185544155_1185544165 25 Left 1185544155 X:928653-928675 CCTTTCTCTGCAACGGAAGCATC No data
Right 1185544165 X:928701-928723 CTGGCTGCTCAGAGGAACTGTGG No data
1185544154_1185544165 26 Left 1185544154 X:928652-928674 CCCTTTCTCTGCAACGGAAGCAT No data
Right 1185544165 X:928701-928723 CTGGCTGCTCAGAGGAACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185544165 Original CRISPR CTGGCTGCTCAGAGGAACTG TGG Intergenic
No off target data available for this crispr