ID: 1185544825

View in Genome Browser
Species Human (GRCh38)
Location X:935153-935175
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185544825_1185544830 -1 Left 1185544825 X:935153-935175 CCTCCGGGGCCCCTAAGAGCAAA No data
Right 1185544830 X:935175-935197 AATGTTGACAAGCGCGTCTTAGG No data
1185544825_1185544831 20 Left 1185544825 X:935153-935175 CCTCCGGGGCCCCTAAGAGCAAA No data
Right 1185544831 X:935196-935218 GGACCTCCACCCTGTTGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185544825 Original CRISPR TTTGCTCTTAGGGGCCCCGG AGG (reversed) Intergenic
No off target data available for this crispr