ID: 1185549484

View in Genome Browser
Species Human (GRCh38)
Location X:971868-971890
Sequence TGTCTATTGCAAAGTGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185549484_1185549489 0 Left 1185549484 X:971868-971890 CCACCCACACTTTGCAATAGACA No data
Right 1185549489 X:971891-971913 CACTCAATGTCCTCCATCTGGGG No data
1185549484_1185549488 -1 Left 1185549484 X:971868-971890 CCACCCACACTTTGCAATAGACA No data
Right 1185549488 X:971890-971912 ACACTCAATGTCCTCCATCTGGG No data
1185549484_1185549487 -2 Left 1185549484 X:971868-971890 CCACCCACACTTTGCAATAGACA No data
Right 1185549487 X:971889-971911 CACACTCAATGTCCTCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185549484 Original CRISPR TGTCTATTGCAAAGTGTGGG TGG (reversed) Intergenic