ID: 1185549485

View in Genome Browser
Species Human (GRCh38)
Location X:971871-971893
Sequence GTGTGTCTATTGCAAAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185549485_1185549488 -4 Left 1185549485 X:971871-971893 CCCACACTTTGCAATAGACACAC No data
Right 1185549488 X:971890-971912 ACACTCAATGTCCTCCATCTGGG No data
1185549485_1185549489 -3 Left 1185549485 X:971871-971893 CCCACACTTTGCAATAGACACAC No data
Right 1185549489 X:971891-971913 CACTCAATGTCCTCCATCTGGGG No data
1185549485_1185549487 -5 Left 1185549485 X:971871-971893 CCCACACTTTGCAATAGACACAC No data
Right 1185549487 X:971889-971911 CACACTCAATGTCCTCCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185549485 Original CRISPR GTGTGTCTATTGCAAAGTGT GGG (reversed) Intergenic