ID: 1185549488

View in Genome Browser
Species Human (GRCh38)
Location X:971890-971912
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185549486_1185549488 -5 Left 1185549486 X:971872-971894 CCACACTTTGCAATAGACACACT No data
Right 1185549488 X:971890-971912 ACACTCAATGTCCTCCATCTGGG No data
1185549484_1185549488 -1 Left 1185549484 X:971868-971890 CCACCCACACTTTGCAATAGACA No data
Right 1185549488 X:971890-971912 ACACTCAATGTCCTCCATCTGGG No data
1185549479_1185549488 26 Left 1185549479 X:971841-971863 CCAACTCAATTTGCTCCATCTGG No data
Right 1185549488 X:971890-971912 ACACTCAATGTCCTCCATCTGGG No data
1185549485_1185549488 -4 Left 1185549485 X:971871-971893 CCCACACTTTGCAATAGACACAC No data
Right 1185549488 X:971890-971912 ACACTCAATGTCCTCCATCTGGG No data
1185549483_1185549488 11 Left 1185549483 X:971856-971878 CCATCTGGGGATCCACCCACACT No data
Right 1185549488 X:971890-971912 ACACTCAATGTCCTCCATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185549488 Original CRISPR ACACTCAATGTCCTCCATCT GGG Intergenic