ID: 1185550592

View in Genome Browser
Species Human (GRCh38)
Location X:980559-980581
Sequence ATCTCAATCCCAGAGAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550592_1185550597 10 Left 1185550592 X:980559-980581 CCTGAACTCTCTGGGATTGAGAT No data
Right 1185550597 X:980592-980614 GTGTCCACACCCTCACCCACTGG No data
1185550592_1185550607 27 Left 1185550592 X:980559-980581 CCTGAACTCTCTGGGATTGAGAT No data
Right 1185550607 X:980609-980631 CACTGGGGCTGCCATGGAGGAGG No data
1185550592_1185550599 12 Left 1185550592 X:980559-980581 CCTGAACTCTCTGGGATTGAGAT No data
Right 1185550599 X:980594-980616 GTCCACACCCTCACCCACTGGGG No data
1185550592_1185550608 30 Left 1185550592 X:980559-980581 CCTGAACTCTCTGGGATTGAGAT No data
Right 1185550608 X:980612-980634 TGGGGCTGCCATGGAGGAGGAGG No data
1185550592_1185550603 21 Left 1185550592 X:980559-980581 CCTGAACTCTCTGGGATTGAGAT No data
Right 1185550603 X:980603-980625 CTCACCCACTGGGGCTGCCATGG No data
1185550592_1185550598 11 Left 1185550592 X:980559-980581 CCTGAACTCTCTGGGATTGAGAT No data
Right 1185550598 X:980593-980615 TGTCCACACCCTCACCCACTGGG No data
1185550592_1185550604 24 Left 1185550592 X:980559-980581 CCTGAACTCTCTGGGATTGAGAT No data
Right 1185550604 X:980606-980628 ACCCACTGGGGCTGCCATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550592 Original CRISPR ATCTCAATCCCAGAGAGTTC AGG (reversed) Intergenic