ID: 1185550600

View in Genome Browser
Species Human (GRCh38)
Location X:980596-980618
Sequence AGCCCCAGTGGGTGAGGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550600_1185550610 -3 Left 1185550600 X:980596-980618 CCACACCCTCACCCACTGGGGCT No data
Right 1185550610 X:980616-980638 GCTGCCATGGAGGAGGAGGAGGG No data
1185550600_1185550607 -10 Left 1185550600 X:980596-980618 CCACACCCTCACCCACTGGGGCT No data
Right 1185550607 X:980609-980631 CACTGGGGCTGCCATGGAGGAGG No data
1185550600_1185550614 22 Left 1185550600 X:980596-980618 CCACACCCTCACCCACTGGGGCT No data
Right 1185550614 X:980641-980663 GTGTCCACACTCTCCACCCTGGG No data
1185550600_1185550617 27 Left 1185550600 X:980596-980618 CCACACCCTCACCCACTGGGGCT No data
Right 1185550617 X:980646-980668 CACACTCTCCACCCTGGGGTTGG No data
1185550600_1185550611 0 Left 1185550600 X:980596-980618 CCACACCCTCACCCACTGGGGCT No data
Right 1185550611 X:980619-980641 GCCATGGAGGAGGAGGAGGGAGG No data
1185550600_1185550608 -7 Left 1185550600 X:980596-980618 CCACACCCTCACCCACTGGGGCT No data
Right 1185550608 X:980612-980634 TGGGGCTGCCATGGAGGAGGAGG No data
1185550600_1185550615 23 Left 1185550600 X:980596-980618 CCACACCCTCACCCACTGGGGCT No data
Right 1185550615 X:980642-980664 TGTCCACACTCTCCACCCTGGGG No data
1185550600_1185550618 28 Left 1185550600 X:980596-980618 CCACACCCTCACCCACTGGGGCT No data
Right 1185550618 X:980647-980669 ACACTCTCCACCCTGGGGTTGGG No data
1185550600_1185550613 21 Left 1185550600 X:980596-980618 CCACACCCTCACCCACTGGGGCT No data
Right 1185550613 X:980640-980662 GGTGTCCACACTCTCCACCCTGG No data
1185550600_1185550609 -4 Left 1185550600 X:980596-980618 CCACACCCTCACCCACTGGGGCT No data
Right 1185550609 X:980615-980637 GGCTGCCATGGAGGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550600 Original CRISPR AGCCCCAGTGGGTGAGGGTG TGG (reversed) Intergenic
No off target data available for this crispr