ID: 1185550602

View in Genome Browser
Species Human (GRCh38)
Location X:980602-980624
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550602_1185550620 29 Left 1185550602 X:980602-980624 CCTCACCCACTGGGGCTGCCATG No data
Right 1185550620 X:980654-980676 CCACCCTGGGGTTGGGATGATGG No data
1185550602_1185550613 15 Left 1185550602 X:980602-980624 CCTCACCCACTGGGGCTGCCATG No data
Right 1185550613 X:980640-980662 GGTGTCCACACTCTCCACCCTGG No data
1185550602_1185550611 -6 Left 1185550602 X:980602-980624 CCTCACCCACTGGGGCTGCCATG No data
Right 1185550611 X:980619-980641 GCCATGGAGGAGGAGGAGGGAGG No data
1185550602_1185550610 -9 Left 1185550602 X:980602-980624 CCTCACCCACTGGGGCTGCCATG No data
Right 1185550610 X:980616-980638 GCTGCCATGGAGGAGGAGGAGGG No data
1185550602_1185550609 -10 Left 1185550602 X:980602-980624 CCTCACCCACTGGGGCTGCCATG No data
Right 1185550609 X:980615-980637 GGCTGCCATGGAGGAGGAGGAGG No data
1185550602_1185550618 22 Left 1185550602 X:980602-980624 CCTCACCCACTGGGGCTGCCATG No data
Right 1185550618 X:980647-980669 ACACTCTCCACCCTGGGGTTGGG No data
1185550602_1185550615 17 Left 1185550602 X:980602-980624 CCTCACCCACTGGGGCTGCCATG No data
Right 1185550615 X:980642-980664 TGTCCACACTCTCCACCCTGGGG No data
1185550602_1185550617 21 Left 1185550602 X:980602-980624 CCTCACCCACTGGGGCTGCCATG No data
Right 1185550617 X:980646-980668 CACACTCTCCACCCTGGGGTTGG No data
1185550602_1185550614 16 Left 1185550602 X:980602-980624 CCTCACCCACTGGGGCTGCCATG No data
Right 1185550614 X:980641-980663 GTGTCCACACTCTCCACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550602 Original CRISPR CATGGCAGCCCCAGTGGGTG AGG (reversed) Intergenic