ID: 1185550605

View in Genome Browser
Species Human (GRCh38)
Location X:980607-980629
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550605_1185550618 17 Left 1185550605 X:980607-980629 CCCACTGGGGCTGCCATGGAGGA No data
Right 1185550618 X:980647-980669 ACACTCTCCACCCTGGGGTTGGG No data
1185550605_1185550614 11 Left 1185550605 X:980607-980629 CCCACTGGGGCTGCCATGGAGGA No data
Right 1185550614 X:980641-980663 GTGTCCACACTCTCCACCCTGGG No data
1185550605_1185550613 10 Left 1185550605 X:980607-980629 CCCACTGGGGCTGCCATGGAGGA No data
Right 1185550613 X:980640-980662 GGTGTCCACACTCTCCACCCTGG No data
1185550605_1185550622 27 Left 1185550605 X:980607-980629 CCCACTGGGGCTGCCATGGAGGA No data
Right 1185550622 X:980657-980679 CCCTGGGGTTGGGATGATGGAGG No data
1185550605_1185550617 16 Left 1185550605 X:980607-980629 CCCACTGGGGCTGCCATGGAGGA No data
Right 1185550617 X:980646-980668 CACACTCTCCACCCTGGGGTTGG No data
1185550605_1185550620 24 Left 1185550605 X:980607-980629 CCCACTGGGGCTGCCATGGAGGA No data
Right 1185550620 X:980654-980676 CCACCCTGGGGTTGGGATGATGG No data
1185550605_1185550615 12 Left 1185550605 X:980607-980629 CCCACTGGGGCTGCCATGGAGGA No data
Right 1185550615 X:980642-980664 TGTCCACACTCTCCACCCTGGGG No data
1185550605_1185550624 30 Left 1185550605 X:980607-980629 CCCACTGGGGCTGCCATGGAGGA No data
Right 1185550624 X:980660-980682 TGGGGTTGGGATGATGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550605 Original CRISPR TCCTCCATGGCAGCCCCAGT GGG (reversed) Intergenic
No off target data available for this crispr