ID: 1185550606

View in Genome Browser
Species Human (GRCh38)
Location X:980608-980630
Sequence CTCCTCCATGGCAGCCCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550606_1185550614 10 Left 1185550606 X:980608-980630 CCACTGGGGCTGCCATGGAGGAG No data
Right 1185550614 X:980641-980663 GTGTCCACACTCTCCACCCTGGG No data
1185550606_1185550622 26 Left 1185550606 X:980608-980630 CCACTGGGGCTGCCATGGAGGAG No data
Right 1185550622 X:980657-980679 CCCTGGGGTTGGGATGATGGAGG No data
1185550606_1185550615 11 Left 1185550606 X:980608-980630 CCACTGGGGCTGCCATGGAGGAG No data
Right 1185550615 X:980642-980664 TGTCCACACTCTCCACCCTGGGG No data
1185550606_1185550617 15 Left 1185550606 X:980608-980630 CCACTGGGGCTGCCATGGAGGAG No data
Right 1185550617 X:980646-980668 CACACTCTCCACCCTGGGGTTGG No data
1185550606_1185550618 16 Left 1185550606 X:980608-980630 CCACTGGGGCTGCCATGGAGGAG No data
Right 1185550618 X:980647-980669 ACACTCTCCACCCTGGGGTTGGG No data
1185550606_1185550613 9 Left 1185550606 X:980608-980630 CCACTGGGGCTGCCATGGAGGAG No data
Right 1185550613 X:980640-980662 GGTGTCCACACTCTCCACCCTGG No data
1185550606_1185550620 23 Left 1185550606 X:980608-980630 CCACTGGGGCTGCCATGGAGGAG No data
Right 1185550620 X:980654-980676 CCACCCTGGGGTTGGGATGATGG No data
1185550606_1185550624 29 Left 1185550606 X:980608-980630 CCACTGGGGCTGCCATGGAGGAG No data
Right 1185550624 X:980660-980682 TGGGGTTGGGATGATGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550606 Original CRISPR CTCCTCCATGGCAGCCCCAG TGG (reversed) Intergenic