ID: 1185550607

View in Genome Browser
Species Human (GRCh38)
Location X:980609-980631
Sequence CACTGGGGCTGCCATGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550600_1185550607 -10 Left 1185550600 X:980596-980618 CCACACCCTCACCCACTGGGGCT No data
Right 1185550607 X:980609-980631 CACTGGGGCTGCCATGGAGGAGG No data
1185550592_1185550607 27 Left 1185550592 X:980559-980581 CCTGAACTCTCTGGGATTGAGAT No data
Right 1185550607 X:980609-980631 CACTGGGGCTGCCATGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550607 Original CRISPR CACTGGGGCTGCCATGGAGG AGG Intergenic