ID: 1185550611

View in Genome Browser
Species Human (GRCh38)
Location X:980619-980641
Sequence GCCATGGAGGAGGAGGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550601_1185550611 -5 Left 1185550601 X:980601-980623 CCCTCACCCACTGGGGCTGCCAT No data
Right 1185550611 X:980619-980641 GCCATGGAGGAGGAGGAGGGAGG No data
1185550602_1185550611 -6 Left 1185550602 X:980602-980624 CCTCACCCACTGGGGCTGCCATG No data
Right 1185550611 X:980619-980641 GCCATGGAGGAGGAGGAGGGAGG No data
1185550600_1185550611 0 Left 1185550600 X:980596-980618 CCACACCCTCACCCACTGGGGCT No data
Right 1185550611 X:980619-980641 GCCATGGAGGAGGAGGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550611 Original CRISPR GCCATGGAGGAGGAGGAGGG AGG Intergenic
No off target data available for this crispr