ID: 1185550612

View in Genome Browser
Species Human (GRCh38)
Location X:980620-980642
Sequence ACCTCCCTCCTCCTCCTCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550612_1185550617 3 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550617 X:980646-980668 CACACTCTCCACCCTGGGGTTGG No data
1185550612_1185550613 -3 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550613 X:980640-980662 GGTGTCCACACTCTCCACCCTGG No data
1185550612_1185550620 11 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550620 X:980654-980676 CCACCCTGGGGTTGGGATGATGG No data
1185550612_1185550622 14 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550622 X:980657-980679 CCCTGGGGTTGGGATGATGGAGG No data
1185550612_1185550614 -2 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550614 X:980641-980663 GTGTCCACACTCTCCACCCTGGG No data
1185550612_1185550618 4 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550618 X:980647-980669 ACACTCTCCACCCTGGGGTTGGG No data
1185550612_1185550626 26 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550626 X:980669-980691 GATGATGGAGGAGGAAGAGGAGG No data
1185550612_1185550625 23 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550625 X:980666-980688 TGGGATGATGGAGGAGGAAGAGG No data
1185550612_1185550624 17 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550624 X:980660-980682 TGGGGTTGGGATGATGGAGGAGG No data
1185550612_1185550627 27 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550627 X:980670-980692 ATGATGGAGGAGGAAGAGGAGGG No data
1185550612_1185550615 -1 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550615 X:980642-980664 TGTCCACACTCTCCACCCTGGGG No data
1185550612_1185550628 28 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550628 X:980671-980693 TGATGGAGGAGGAAGAGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550612 Original CRISPR ACCTCCCTCCTCCTCCTCCA TGG (reversed) Intergenic