ID: 1185550613

View in Genome Browser
Species Human (GRCh38)
Location X:980640-980662
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550612_1185550613 -3 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550613 X:980640-980662 GGTGTCCACACTCTCCACCCTGG No data
1185550600_1185550613 21 Left 1185550600 X:980596-980618 CCACACCCTCACCCACTGGGGCT No data
Right 1185550613 X:980640-980662 GGTGTCCACACTCTCCACCCTGG No data
1185550606_1185550613 9 Left 1185550606 X:980608-980630 CCACTGGGGCTGCCATGGAGGAG No data
Right 1185550613 X:980640-980662 GGTGTCCACACTCTCCACCCTGG No data
1185550605_1185550613 10 Left 1185550605 X:980607-980629 CCCACTGGGGCTGCCATGGAGGA No data
Right 1185550613 X:980640-980662 GGTGTCCACACTCTCCACCCTGG No data
1185550601_1185550613 16 Left 1185550601 X:980601-980623 CCCTCACCCACTGGGGCTGCCAT No data
Right 1185550613 X:980640-980662 GGTGTCCACACTCTCCACCCTGG No data
1185550602_1185550613 15 Left 1185550602 X:980602-980624 CCTCACCCACTGGGGCTGCCATG No data
Right 1185550613 X:980640-980662 GGTGTCCACACTCTCCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550613 Original CRISPR GGTGTCCACACTCTCCACCC TGG Intergenic
No off target data available for this crispr