ID: 1185550622

View in Genome Browser
Species Human (GRCh38)
Location X:980657-980679
Sequence CCCTGGGGTTGGGATGATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550605_1185550622 27 Left 1185550605 X:980607-980629 CCCACTGGGGCTGCCATGGAGGA No data
Right 1185550622 X:980657-980679 CCCTGGGGTTGGGATGATGGAGG No data
1185550612_1185550622 14 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550622 X:980657-980679 CCCTGGGGTTGGGATGATGGAGG No data
1185550606_1185550622 26 Left 1185550606 X:980608-980630 CCACTGGGGCTGCCATGGAGGAG No data
Right 1185550622 X:980657-980679 CCCTGGGGTTGGGATGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550622 Original CRISPR CCCTGGGGTTGGGATGATGG AGG Intergenic