ID: 1185550624

View in Genome Browser
Species Human (GRCh38)
Location X:980660-980682
Sequence TGGGGTTGGGATGATGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550606_1185550624 29 Left 1185550606 X:980608-980630 CCACTGGGGCTGCCATGGAGGAG No data
Right 1185550624 X:980660-980682 TGGGGTTGGGATGATGGAGGAGG No data
1185550605_1185550624 30 Left 1185550605 X:980607-980629 CCCACTGGGGCTGCCATGGAGGA No data
Right 1185550624 X:980660-980682 TGGGGTTGGGATGATGGAGGAGG No data
1185550616_1185550624 -8 Left 1185550616 X:980645-980667 CCACACTCTCCACCCTGGGGTTG No data
Right 1185550624 X:980660-980682 TGGGGTTGGGATGATGGAGGAGG No data
1185550612_1185550624 17 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550624 X:980660-980682 TGGGGTTGGGATGATGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550624 Original CRISPR TGGGGTTGGGATGATGGAGG AGG Intergenic