ID: 1185550625

View in Genome Browser
Species Human (GRCh38)
Location X:980666-980688
Sequence TGGGATGATGGAGGAGGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550612_1185550625 23 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550625 X:980666-980688 TGGGATGATGGAGGAGGAAGAGG No data
1185550616_1185550625 -2 Left 1185550616 X:980645-980667 CCACACTCTCCACCCTGGGGTTG No data
Right 1185550625 X:980666-980688 TGGGATGATGGAGGAGGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550625 Original CRISPR TGGGATGATGGAGGAGGAAG AGG Intergenic