ID: 1185550626

View in Genome Browser
Species Human (GRCh38)
Location X:980669-980691
Sequence GATGATGGAGGAGGAAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550619_1185550626 -8 Left 1185550619 X:980654-980676 CCACCCTGGGGTTGGGATGATGG No data
Right 1185550626 X:980669-980691 GATGATGGAGGAGGAAGAGGAGG No data
1185550612_1185550626 26 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550626 X:980669-980691 GATGATGGAGGAGGAAGAGGAGG No data
1185550616_1185550626 1 Left 1185550616 X:980645-980667 CCACACTCTCCACCCTGGGGTTG No data
Right 1185550626 X:980669-980691 GATGATGGAGGAGGAAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550626 Original CRISPR GATGATGGAGGAGGAAGAGG AGG Intergenic