ID: 1185550627

View in Genome Browser
Species Human (GRCh38)
Location X:980670-980692
Sequence ATGATGGAGGAGGAAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550616_1185550627 2 Left 1185550616 X:980645-980667 CCACACTCTCCACCCTGGGGTTG No data
Right 1185550627 X:980670-980692 ATGATGGAGGAGGAAGAGGAGGG No data
1185550621_1185550627 -10 Left 1185550621 X:980657-980679 CCCTGGGGTTGGGATGATGGAGG No data
Right 1185550627 X:980670-980692 ATGATGGAGGAGGAAGAGGAGGG No data
1185550612_1185550627 27 Left 1185550612 X:980620-980642 CCATGGAGGAGGAGGAGGGAGGT No data
Right 1185550627 X:980670-980692 ATGATGGAGGAGGAAGAGGAGGG No data
1185550619_1185550627 -7 Left 1185550619 X:980654-980676 CCACCCTGGGGTTGGGATGATGG No data
Right 1185550627 X:980670-980692 ATGATGGAGGAGGAAGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550627 Original CRISPR ATGATGGAGGAGGAAGAGGA GGG Intergenic