ID: 1185550847

View in Genome Browser
Species Human (GRCh38)
Location X:981379-981401
Sequence GTGTCCACACTCTGCCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185550839_1185550847 12 Left 1185550839 X:981344-981366 CCCACTGGGGCTGGGATGGAGGA No data
Right 1185550847 X:981379-981401 GTGTCCACACTCTGCCCTCTGGG No data
1185550837_1185550847 13 Left 1185550837 X:981343-981365 CCCCACTGGGGCTGGGATGGAGG No data
Right 1185550847 X:981379-981401 GTGTCCACACTCTGCCCTCTGGG No data
1185550833_1185550847 22 Left 1185550833 X:981334-981356 CCACACTCTCCCCACTGGGGCTG No data
Right 1185550847 X:981379-981401 GTGTCCACACTCTGCCCTCTGGG No data
1185550829_1185550847 28 Left 1185550829 X:981328-981350 CCGTGTCCACACTCTCCCCACTG No data
Right 1185550847 X:981379-981401 GTGTCCACACTCTGCCCTCTGGG No data
1185550840_1185550847 11 Left 1185550840 X:981345-981367 CCACTGGGGCTGGGATGGAGGAG No data
Right 1185550847 X:981379-981401 GTGTCCACACTCTGCCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185550847 Original CRISPR GTGTCCACACTCTGCCCTCT GGG Intergenic
No off target data available for this crispr