ID: 1185551259

View in Genome Browser
Species Human (GRCh38)
Location X:984074-984096
Sequence CCATAGGTAGTATTGGAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185551259_1185551269 7 Left 1185551259 X:984074-984096 CCCGTTTCCAATACTACCTATGG No data
Right 1185551269 X:984104-984126 CTCCCCACTTCCCTTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185551259 Original CRISPR CCATAGGTAGTATTGGAAAC GGG (reversed) Intergenic
No off target data available for this crispr