ID: 1185551269

View in Genome Browser
Species Human (GRCh38)
Location X:984104-984126
Sequence CTCCCCACTTCCCTTCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185551262_1185551269 0 Left 1185551262 X:984081-984103 CCAATACTACCTATGGCCCGCCC No data
Right 1185551269 X:984104-984126 CTCCCCACTTCCCTTCTCTGAGG No data
1185551263_1185551269 -9 Left 1185551263 X:984090-984112 CCTATGGCCCGCCCCTCCCCACT No data
Right 1185551269 X:984104-984126 CTCCCCACTTCCCTTCTCTGAGG No data
1185551261_1185551269 6 Left 1185551261 X:984075-984097 CCGTTTCCAATACTACCTATGGC 0: 21
1: 52
2: 86
3: 192
4: 308
Right 1185551269 X:984104-984126 CTCCCCACTTCCCTTCTCTGAGG No data
1185551259_1185551269 7 Left 1185551259 X:984074-984096 CCCGTTTCCAATACTACCTATGG No data
Right 1185551269 X:984104-984126 CTCCCCACTTCCCTTCTCTGAGG No data
1185551258_1185551269 28 Left 1185551258 X:984053-984075 CCTTTTAATCAATCAAATGTTCC No data
Right 1185551269 X:984104-984126 CTCCCCACTTCCCTTCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185551269 Original CRISPR CTCCCCACTTCCCTTCTCTG AGG Intergenic
No off target data available for this crispr