ID: 1185552788

View in Genome Browser
Species Human (GRCh38)
Location X:997447-997469
Sequence GACCCTGGGCTTCACCCACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185552788_1185552793 19 Left 1185552788 X:997447-997469 CCTGGTGGGTGAAGCCCAGGGTC No data
Right 1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG No data
1185552788_1185552791 4 Left 1185552788 X:997447-997469 CCTGGTGGGTGAAGCCCAGGGTC No data
Right 1185552791 X:997474-997496 CTCAACACCATACAGTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185552788 Original CRISPR GACCCTGGGCTTCACCCACC AGG (reversed) Intergenic
No off target data available for this crispr