ID: 1185552790

View in Genome Browser
Species Human (GRCh38)
Location X:997462-997484
Sequence ATGGTGTTGAGCAGAGACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185552790_1185552793 4 Left 1185552790 X:997462-997484 CCAGGGTCTCTGCTCAACACCAT No data
Right 1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185552790 Original CRISPR ATGGTGTTGAGCAGAGACCC TGG (reversed) Intergenic
No off target data available for this crispr