ID: 1185552793

View in Genome Browser
Species Human (GRCh38)
Location X:997489-997511
Sequence TGCCCAGGACAGCCCCACCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185552788_1185552793 19 Left 1185552788 X:997447-997469 CCTGGTGGGTGAAGCCCAGGGTC No data
Right 1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG No data
1185552789_1185552793 5 Left 1185552789 X:997461-997483 CCCAGGGTCTCTGCTCAACACCA No data
Right 1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG No data
1185552785_1185552793 26 Left 1185552785 X:997440-997462 CCTGGCACCTGGTGGGTGAAGCC No data
Right 1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG No data
1185552790_1185552793 4 Left 1185552790 X:997462-997484 CCAGGGTCTCTGCTCAACACCAT No data
Right 1185552793 X:997489-997511 TGCCCAGGACAGCCCCACCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185552793 Original CRISPR TGCCCAGGACAGCCCCACCG CGG Intergenic
No off target data available for this crispr