ID: 1185553576

View in Genome Browser
Species Human (GRCh38)
Location X:1002911-1002933
Sequence AAATGGGAACAGATGTAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185553576_1185553585 4 Left 1185553576 X:1002911-1002933 CCCGGCTACATCTGTTCCCATTT No data
Right 1185553585 X:1002938-1002960 CTCGGCCGGGCCATACCAGCGGG No data
1185553576_1185553580 -9 Left 1185553576 X:1002911-1002933 CCCGGCTACATCTGTTCCCATTT No data
Right 1185553580 X:1002925-1002947 TTCCCATTTTCTCCTCGGCCGGG No data
1185553576_1185553584 3 Left 1185553576 X:1002911-1002933 CCCGGCTACATCTGTTCCCATTT No data
Right 1185553584 X:1002937-1002959 CCTCGGCCGGGCCATACCAGCGG No data
1185553576_1185553579 -10 Left 1185553576 X:1002911-1002933 CCCGGCTACATCTGTTCCCATTT No data
Right 1185553579 X:1002924-1002946 GTTCCCATTTTCTCCTCGGCCGG No data
1185553576_1185553587 9 Left 1185553576 X:1002911-1002933 CCCGGCTACATCTGTTCCCATTT No data
Right 1185553587 X:1002943-1002965 CCGGGCCATACCAGCGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185553576 Original CRISPR AAATGGGAACAGATGTAGCC GGG (reversed) Intergenic
No off target data available for this crispr