ID: 1185553579

View in Genome Browser
Species Human (GRCh38)
Location X:1002924-1002946
Sequence GTTCCCATTTTCTCCTCGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185553575_1185553579 -9 Left 1185553575 X:1002910-1002932 CCCCGGCTACATCTGTTCCCATT No data
Right 1185553579 X:1002924-1002946 GTTCCCATTTTCTCCTCGGCCGG No data
1185553573_1185553579 8 Left 1185553573 X:1002893-1002915 CCAGATTCTGAAGGCGTCCCCGG No data
Right 1185553579 X:1002924-1002946 GTTCCCATTTTCTCCTCGGCCGG No data
1185553576_1185553579 -10 Left 1185553576 X:1002911-1002933 CCCGGCTACATCTGTTCCCATTT No data
Right 1185553579 X:1002924-1002946 GTTCCCATTTTCTCCTCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185553579 Original CRISPR GTTCCCATTTTCTCCTCGGC CGG Intergenic
No off target data available for this crispr