ID: 1185553580

View in Genome Browser
Species Human (GRCh38)
Location X:1002925-1002947
Sequence TTCCCATTTTCTCCTCGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185553573_1185553580 9 Left 1185553573 X:1002893-1002915 CCAGATTCTGAAGGCGTCCCCGG No data
Right 1185553580 X:1002925-1002947 TTCCCATTTTCTCCTCGGCCGGG No data
1185553575_1185553580 -8 Left 1185553575 X:1002910-1002932 CCCCGGCTACATCTGTTCCCATT No data
Right 1185553580 X:1002925-1002947 TTCCCATTTTCTCCTCGGCCGGG No data
1185553577_1185553580 -10 Left 1185553577 X:1002912-1002934 CCGGCTACATCTGTTCCCATTTT No data
Right 1185553580 X:1002925-1002947 TTCCCATTTTCTCCTCGGCCGGG No data
1185553576_1185553580 -9 Left 1185553576 X:1002911-1002933 CCCGGCTACATCTGTTCCCATTT No data
Right 1185553580 X:1002925-1002947 TTCCCATTTTCTCCTCGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185553580 Original CRISPR TTCCCATTTTCTCCTCGGCC GGG Intergenic
No off target data available for this crispr