ID: 1185559143

View in Genome Browser
Species Human (GRCh38)
Location X:1045276-1045298
Sequence GTTGGGGCAGGATCCTGTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185559143_1185559150 -6 Left 1185559143 X:1045276-1045298 CCTTTACAGGATCCTGCCCCAAC No data
Right 1185559150 X:1045293-1045315 CCCAACCCAGGGGATGAACCAGG No data
1185559143_1185559156 20 Left 1185559143 X:1045276-1045298 CCTTTACAGGATCCTGCCCCAAC No data
Right 1185559156 X:1045319-1045341 GTCGATCTGTTCCCCATTTCTGG No data
1185559143_1185559152 -2 Left 1185559143 X:1045276-1045298 CCTTTACAGGATCCTGCCCCAAC No data
Right 1185559152 X:1045297-1045319 ACCCAGGGGATGAACCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185559143 Original CRISPR GTTGGGGCAGGATCCTGTAA AGG (reversed) Intergenic
No off target data available for this crispr