ID: 1185560908

View in Genome Browser
Species Human (GRCh38)
Location X:1060072-1060094
Sequence CGGCGTTCAGCAGTGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185560908_1185560920 24 Left 1185560908 X:1060072-1060094 CCGTCCACCACTGCTGAACGCCG No data
Right 1185560920 X:1060119-1060141 CCACCCCTCCGGATCAGGCAGGG No data
1185560908_1185560915 13 Left 1185560908 X:1060072-1060094 CCGTCCACCACTGCTGAACGCCG No data
Right 1185560915 X:1060108-1060130 ACCTTTGAGTTCCACCCCTCCGG No data
1185560908_1185560918 23 Left 1185560908 X:1060072-1060094 CCGTCCACCACTGCTGAACGCCG No data
Right 1185560918 X:1060118-1060140 TCCACCCCTCCGGATCAGGCAGG No data
1185560908_1185560917 19 Left 1185560908 X:1060072-1060094 CCGTCCACCACTGCTGAACGCCG No data
Right 1185560917 X:1060114-1060136 GAGTTCCACCCCTCCGGATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185560908 Original CRISPR CGGCGTTCAGCAGTGGTGGA CGG (reversed) Intergenic
No off target data available for this crispr