ID: 1185569729

View in Genome Browser
Species Human (GRCh38)
Location X:1124339-1124361
Sequence CCCTGCGTTTGCAGCGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185569729_1185569735 3 Left 1185569729 X:1124339-1124361 CCATCTTCGCTGCAAACGCAGGG No data
Right 1185569735 X:1124365-1124387 CCTTCCAGCCTCCACACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185569729 Original CRISPR CCCTGCGTTTGCAGCGAAGA TGG (reversed) Intergenic
No off target data available for this crispr