ID: 1185569734

View in Genome Browser
Species Human (GRCh38)
Location X:1124365-1124387
Sequence CCATGTGTGTGGAGGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185569734_1185569741 23 Left 1185569734 X:1124365-1124387 CCTTCCAGCCTCCACACACATGG No data
Right 1185569741 X:1124411-1124433 GAAACAGAGCTTTACACTTTGGG No data
1185569734_1185569740 22 Left 1185569734 X:1124365-1124387 CCTTCCAGCCTCCACACACATGG No data
Right 1185569740 X:1124410-1124432 TGAAACAGAGCTTTACACTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185569734 Original CRISPR CCATGTGTGTGGAGGCTGGA AGG (reversed) Intergenic
No off target data available for this crispr