ID: 1185573848

View in Genome Browser
Species Human (GRCh38)
Location X:1154743-1154765
Sequence CACGCCCGGCTGATGTTTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185573839_1185573848 18 Left 1185573839 X:1154702-1154724 CCTCAGCCTCCTGAGTAAGTGGG 0: 53
1: 4015
2: 107063
3: 211990
4: 241017
Right 1185573848 X:1154743-1154765 CACGCCCGGCTGATGTTTTTAGG No data
1185573843_1185573848 9 Left 1185573843 X:1154711-1154733 CCTGAGTAAGTGGGATTACAGGC 0: 34
1: 3025
2: 85050
3: 219633
4: 232790
Right 1185573848 X:1154743-1154765 CACGCCCGGCTGATGTTTTTAGG No data
1185573841_1185573848 12 Left 1185573841 X:1154708-1154730 CCTCCTGAGTAAGTGGGATTACA 0: 35
1: 2343
2: 63124
3: 153336
4: 236866
Right 1185573848 X:1154743-1154765 CACGCCCGGCTGATGTTTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185573848 Original CRISPR CACGCCCGGCTGATGTTTTT AGG Intergenic
No off target data available for this crispr