ID: 1185575702

View in Genome Browser
Species Human (GRCh38)
Location X:1170486-1170508
Sequence CTGCTACATTCTTAGCATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185575702_1185575707 30 Left 1185575702 X:1170486-1170508 CCAGCATGCTAAGAATGTAGCAG No data
Right 1185575707 X:1170539-1170561 CACCAGATTAAAGAAGGAACAGG No data
1185575702_1185575706 24 Left 1185575702 X:1170486-1170508 CCAGCATGCTAAGAATGTAGCAG No data
Right 1185575706 X:1170533-1170555 CTCAGACACCAGATTAAAGAAGG 0: 22
1: 77
2: 142
3: 315
4: 387

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185575702 Original CRISPR CTGCTACATTCTTAGCATGC TGG (reversed) Intergenic
No off target data available for this crispr