ID: 1185582686

View in Genome Browser
Species Human (GRCh38)
Location X:1223147-1223169
Sequence GCATGGACAATGAGTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185582681_1185582686 18 Left 1185582681 X:1223106-1223128 CCACAAACCAATATTCTGTTGTT No data
Right 1185582686 X:1223147-1223169 GCATGGACAATGAGTCAGCTGGG No data
1185582682_1185582686 11 Left 1185582682 X:1223113-1223135 CCAATATTCTGTTGTTTGTGTTT No data
Right 1185582686 X:1223147-1223169 GCATGGACAATGAGTCAGCTGGG No data
1185582680_1185582686 23 Left 1185582680 X:1223101-1223123 CCAAACCACAAACCAATATTCTG No data
Right 1185582686 X:1223147-1223169 GCATGGACAATGAGTCAGCTGGG No data
1185582679_1185582686 24 Left 1185582679 X:1223100-1223122 CCCAAACCACAAACCAATATTCT No data
Right 1185582686 X:1223147-1223169 GCATGGACAATGAGTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185582686 Original CRISPR GCATGGACAATGAGTCAGCT GGG Intergenic
No off target data available for this crispr