ID: 1185585037

View in Genome Browser
Species Human (GRCh38)
Location X:1236476-1236498
Sequence GAGGGGCTCACTTCCCAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185585037_1185585053 28 Left 1185585037 X:1236476-1236498 CCCTACTGGGAAGTGAGCCCCTC No data
Right 1185585053 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1185585037_1185585051 27 Left 1185585037 X:1236476-1236498 CCCTACTGGGAAGTGAGCCCCTC No data
Right 1185585051 X:1236526-1236548 GCCCAACAGCTCATTGAGAACGG 0: 406
1: 1143
2: 373
3: 77
4: 235
1185585037_1185585046 1 Left 1185585037 X:1236476-1236498 CCCTACTGGGAAGTGAGCCCCTC No data
Right 1185585046 X:1236500-1236522 GCCCTCTGGGCCCGTCTGGGAGG No data
1185585037_1185585044 -3 Left 1185585037 X:1236476-1236498 CCCTACTGGGAAGTGAGCCCCTC No data
Right 1185585044 X:1236496-1236518 CTCTGCCCTCTGGGCCCGTCTGG No data
1185585037_1185585045 -2 Left 1185585037 X:1236476-1236498 CCCTACTGGGAAGTGAGCCCCTC No data
Right 1185585045 X:1236497-1236519 TCTGCCCTCTGGGCCCGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185585037 Original CRISPR GAGGGGCTCACTTCCCAGTA GGG (reversed) Intergenic
No off target data available for this crispr