ID: 1185585043

View in Genome Browser
Species Human (GRCh38)
Location X:1236495-1236517
Sequence CAGACGGGCCCAGAGGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185585043_1185585051 8 Left 1185585043 X:1236495-1236517 CCTCTGCCCTCTGGGCCCGTCTG No data
Right 1185585051 X:1236526-1236548 GCCCAACAGCTCATTGAGAACGG 0: 406
1: 1143
2: 373
3: 77
4: 235
1185585043_1185585055 24 Left 1185585043 X:1236495-1236517 CCTCTGCCCTCTGGGCCCGTCTG No data
Right 1185585055 X:1236542-1236564 AGAACGGGCCATGATGACGATGG 0: 414
1: 1018
2: 754
3: 186
4: 228
1185585043_1185585056 27 Left 1185585043 X:1236495-1236517 CCTCTGCCCTCTGGGCCCGTCTG No data
Right 1185585056 X:1236545-1236567 ACGGGCCATGATGACGATGGCGG 0: 363
1: 891
2: 815
3: 196
4: 115
1185585043_1185585053 9 Left 1185585043 X:1236495-1236517 CCTCTGCCCTCTGGGCCCGTCTG No data
Right 1185585053 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185585043 Original CRISPR CAGACGGGCCCAGAGGGCAG AGG (reversed) Intergenic
No off target data available for this crispr