ID: 1185585050

View in Genome Browser
Species Human (GRCh38)
Location X:1236511-1236533
Sequence TGTTGGGCACACCTCCCAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2347
Summary {0: 409, 1: 1169, 2: 547, 3: 86, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185585050_1185585051 -8 Left 1185585050 X:1236511-1236533 CCGTCTGGGAGGTGTGCCCAACA 0: 409
1: 1169
2: 547
3: 86
4: 136
Right 1185585051 X:1236526-1236548 GCCCAACAGCTCATTGAGAACGG 0: 406
1: 1143
2: 373
3: 77
4: 235
1185585050_1185585058 19 Left 1185585050 X:1236511-1236533 CCGTCTGGGAGGTGTGCCCAACA 0: 409
1: 1169
2: 547
3: 86
4: 136
Right 1185585058 X:1236553-1236575 TGATGACGATGGCGGTTTTGTGG 0: 67
1: 782
2: 384
3: 414
4: 343
1185585050_1185585056 11 Left 1185585050 X:1236511-1236533 CCGTCTGGGAGGTGTGCCCAACA 0: 409
1: 1169
2: 547
3: 86
4: 136
Right 1185585056 X:1236545-1236567 ACGGGCCATGATGACGATGGCGG 0: 363
1: 891
2: 815
3: 196
4: 115
1185585050_1185585060 30 Left 1185585050 X:1236511-1236533 CCGTCTGGGAGGTGTGCCCAACA 0: 409
1: 1169
2: 547
3: 86
4: 136
Right 1185585060 X:1236564-1236586 GCGGTTTTGTGGAATAGAAAGGG 0: 657
1: 570
2: 352
3: 176
4: 245
1185585050_1185585055 8 Left 1185585050 X:1236511-1236533 CCGTCTGGGAGGTGTGCCCAACA 0: 409
1: 1169
2: 547
3: 86
4: 136
Right 1185585055 X:1236542-1236564 AGAACGGGCCATGATGACGATGG 0: 414
1: 1018
2: 754
3: 186
4: 228
1185585050_1185585059 29 Left 1185585050 X:1236511-1236533 CCGTCTGGGAGGTGTGCCCAACA 0: 409
1: 1169
2: 547
3: 86
4: 136
Right 1185585059 X:1236563-1236585 GGCGGTTTTGTGGAATAGAAAGG 0: 590
1: 532
2: 122
3: 50
4: 121
1185585050_1185585053 -7 Left 1185585050 X:1236511-1236533 CCGTCTGGGAGGTGTGCCCAACA 0: 409
1: 1169
2: 547
3: 86
4: 136
Right 1185585053 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185585050 Original CRISPR TGTTGGGCACACCTCCCAGA CGG (reversed) Intergenic
Too many off-targets to display for this crispr