ID: 1185585053

View in Genome Browser
Species Human (GRCh38)
Location X:1236527-1236549
Sequence CCCAACAGCTCATTGAGAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2279
Summary {0: 1398, 1: 571, 2: 139, 3: 41, 4: 130}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1185585047_1185585053 3 Left 1185585047 X:1236501-1236523 CCCTCTGGGCCCGTCTGGGAGGT No data
Right 1185585053 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1185585049_1185585053 -6 Left 1185585049 X:1236510-1236532 CCCGTCTGGGAGGTGTGCCCAAC 0: 415
1: 1252
2: 539
3: 139
4: 141
Right 1185585053 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1185585050_1185585053 -7 Left 1185585050 X:1236511-1236533 CCGTCTGGGAGGTGTGCCCAACA 0: 409
1: 1169
2: 547
3: 86
4: 136
Right 1185585053 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1185585036_1185585053 29 Left 1185585036 X:1236475-1236497 CCCCTACTGGGAAGTGAGCCCCT No data
Right 1185585053 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1185585037_1185585053 28 Left 1185585037 X:1236476-1236498 CCCTACTGGGAAGTGAGCCCCTC No data
Right 1185585053 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1185585043_1185585053 9 Left 1185585043 X:1236495-1236517 CCTCTGCCCTCTGGGCCCGTCTG No data
Right 1185585053 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1185585042_1185585053 10 Left 1185585042 X:1236494-1236516 CCCTCTGCCCTCTGGGCCCGTCT No data
Right 1185585053 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1185585048_1185585053 2 Left 1185585048 X:1236502-1236524 CCTCTGGGCCCGTCTGGGAGGTG No data
Right 1185585053 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1185585038_1185585053 27 Left 1185585038 X:1236477-1236499 CCTACTGGGAAGTGAGCCCCTCT No data
Right 1185585053 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
1185585041_1185585053 11 Left 1185585041 X:1236493-1236515 CCCCTCTGCCCTCTGGGCCCGTC No data
Right 1185585053 X:1236527-1236549 CCCAACAGCTCATTGAGAACGGG 0: 1398
1: 571
2: 139
3: 41
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1185585053 Original CRISPR CCCAACAGCTCATTGAGAAC GGG Intergenic
Too many off-targets to display for this crispr